nucleic_acid 0.0.7

This is a package for nucleic acid analysis support. This package is made for scientists.

nucleic_acid

(en)Japanese ver is here.
(ja)この解説の日本語版はここにあります。

Overview

This is a package for nucleic acid analysis support. This package is made for scientists.

Usage

NucleotideSequence gene = NucleotideSequence("attgac");
NucleotideSequence templateDNA = gene.complemented(EnumNucleotideSequenceType.dna);

// Transcription
NucleotideSequence mRNA = gene.converted(EnumNucleotideSequenceType.rna);
NucleotideSequence tRNA = mRNA.complemented(EnumNucleotideSequenceType.rna);

// Translation
AminoAcidSequence peptide = AminoAcidSequence(mRNA);

// Translation(direct)
AminoAcidSequence peptideFromDNA = AminoAcidSequence(gene);

// Extension
// attgacattgac
NucleotideSequence gene2 = gene + gene;
// attgaccagtta
NucleotideSequence gene3 = gene + gene.reversed();
// attgacattgac
gene.add(gene.reversed(), useDirection: true);

// Copy
NucleotideSequence geneCopy = gene.deepCopy();

// Get sub sequence
NucleotideSequence gac = NucleotideSequence("attgac").subSeq(3);

File format conversion

    // FASTA
    String fastaContent = '>sequence1\n';
    String seq1 = 'ATGCAGTAGCTAGCTACGT';
    fastaContent += "$seq1\n";
    fastaContent += '>sequence2\n';
    String seq2 = 'CGTAGCTAGCTAGCATCGT';
    fastaContent += "$seq2\n";
    List<NucleotideSequence> nSeq = UtilFasta.read(fastaContent);
    String reConvertFasta = UtilFasta.write(nSeq[0], "sequence1");

Array search

    // Search ecoRI position
    final NucleotideSequence seq =
        NucleotideSequence('ATGAATTCAGAATTCTATATATATATACC'.toLowerCase());
    final NucleotideSequence ecoRI = NucleotideSequence('GAATTC'.toLowerCase());
    // get 2 and 9.
    List<int> ecoRIPositions = UtilNucleotideSearch.getPositions(seq, ecoRI, true);

    // A fuzzy search is also possible.
    final NucleotideSequence fuzzyEcoRI = NucleotideSequence('GNMTTC'.toLowerCase());
    // get 2 and 9.
    List<int> ecoRIPositions2 = UtilNucleotideSearch.getPositions(seq, fuzzyEcoRI, true, fuzzyComp: true);
    
    // Searching for tandem repeats
    // get tRepeat[0][0] = 15 (start position), tRepeat[0][1] = 27 (end position).
    List<List<int>> tRepeats = UtilNucleotideSearch.tandemRepeat(seq, 2, 2, true);
    
    // A similar API is available for AminoAcidSequence.
    AminoAcidSequence aaSeq = AminoAcidSequence.fromStr("MVWWLALALAANYY");
    AminoAcidSequence target = AminoAcidSequence.fromStr("LXLXLXXN");
    // get tPositions[0] == 4.
    List<int> tPositions = UtilAminoAcidSearch.getPositions(aaSeq, target, true, fuzzyComp: true);

About the data structure (decoded state)

The basic data structure in this package is as follows.

• NucleotideSequence

  • sequence: List
    • nucleotide: Nucleotide
      • base: EnumBase, The type of base.
      • infoKey: String?, nucleotideInfo key that can be used when considering chemical modification.
  • type: EnumNucleotideSequenceType, DNA or RNA.
  • direction: EnumNucleotideSequenceDirection, The direction of sequence。
  • id: String?, The serial ID of this sequence。
  • description: String?, The description of this sequence。
  • info: Map<String, dynamic>?, The other data of this sequence。
  • nucleotideInfo: Map<String, NucleotideInfo>?, Reference for detailed information about the nucleotides in this sequence.
    • key: String, A reference key that a Nucleotide has. For example, aliases when chemically decorated.
    • value: NucleotideInfo, Information such as chemical modification of Nucleotide.

• AminoAcidSequence

  • sequence: List
    • nucleotide: AminoAcid
      • type: EnumAminoAcid, The type of amino acid。
      • infoKey: String?, aminoAcidInfo key that can be used when considering chemical modification.
  • direction: EnumAminoAcidSequenceDirection, The direction of sequence。
  • id: String?, The serial ID of this sequence。
  • description: String?, The description of this sequence。
  • info: Map<String, dynamic>?, The other data of this sequence。
  • aminoAcidInfo: Map<String, NucleotideInfo>?, Reference for detailed information about the AminoAcids in this sequence.
    • key: String, A reference key that a AminoAcid has. For example, aliases when chemically decorated.
    • value: AminoAcidInfo, Information such as chemical modification of AminoAcid.

Support

If you need paid support for any reason, please contact my company.
This package is developed by me personally, but may be supported via the company.
SimpleAppli Inc.

About version control

The C part will be changed at the time of version upgrade.
However, versions less than 1.0.0 may change the file structure regardless of the following rules.

• Changes such as adding variables, structure change that cause problems when reading previous files.
  • C.X.X
• Adding methods, etc.
  • X.C.X
• Minor changes and bug fixes.
  • X.X.C

License

This software is released under the MIT License, see LICENSE file.

Copyright notice

The “Dart” name and “Flutter” name are trademarks of Google LLC.
*The developer of this package is not Google LLC.